Товары в корзине: 0 шт Оформить заказ
Стр. 1
 

23 страницы

612.00 ₽

Купить ГОСТ 34104-2017 — официальный бумажный документ с голограммой и синими печатями. подробнее

Официально распространяем нормативную документацию с 1999 года. Пробиваем чеки, платим налоги, принимаем к оплате все законные формы платежей без дополнительных процентов. Наши клиенты защищены Законом. ООО "ЦНТИ Нормоконтроль".

Наши цены ниже, чем в других местах, потому что мы работаем напрямую с поставщиками документов.

Способы доставки

  • Срочная курьерская доставка (1-3 дня)
  • Курьерская доставка (7 дней)
  • Самовывоз из московского офиса
  • Почта РФ

Распространяется на корма: фуражное зерно, продукты его переработки; растительные корма; комбикорма для продуктивных и непродуктивных животных и сырье для их производства; кормовые добавки и устанавливает метод идентификации генно-модифицированной сои, генно-модифицирован-ной кукурузы и генно-модифицированного рапса методом полимеразной цепной реакции с гибридизационно-флуоресцентной детекцией в режиме реального времени (Real Time PCR).

  Скачать PDF

Действие завершено 01.07.2018

Оглавление

1 Область применения

2 Нормативные ссылки

3 Термины и определения

4 Условия выполнения исследований и требования безопасности

5 Оборудование, материалы, реагенты

6 Сущность метода

7 Отбор проб

8 Экстракция ДНК

9 Постановка ПЦР и проведение амплификации с гибридизационно-флуоресцентной детекцией в режиме реального времени (Real Time PCR)

Приложение А (справочное) Требования к ПЦР-лаборатории

Показать даты введения Admin

МЕЖГОСУДАРСТВЕННЫЙ СОВЕТ ПО СТАНДАРТИЗАЦИИ, МЕТРОЛОГИИ И СЕРТИФИКАЦИИ

(МГС)

INTERSTATE COUNCIL FOR STANDARDIZATION, METROLOGY AND CERTIFICATION

(ISC)

МЕЖГОСУДАРСТВЕННЫЙ

СТАНДАРТ

КОРМА И КОРМОВЫЕ ДОБАВКИ

Метод идентификации генетически модифицированных линий сои, кукурузы и рапса с использованием ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального времени

Издание официальное

ГОСТ

34104—

2017

Москва

Стандартинформ

2017


Предисловие

Цели, основные принципы и основной порядок проведения работ по межгосударственной стандартизации установлены в ГОСТ 1.0-2015 «Межгосударственная система стандартизации. Основные положения» и ГОСТ 1.2-2015 «Межгосударственная система стандартизации. Стандарты межгосударственные. правила и рекомендации по межгосударственной стандартизации. Правила разработки, принятия. обновления и отмены»

Сведения о стандарте

1    РАЗРАБОТАН Федеральным государственным бюджетным учреждением «Всероссийский государственный Центр качества и стандартизации лекарственных средств для животных и кормов» (ФГБУ «ВГНКИ»)

2    ВНЕСЕН Федеральным агентством по техническому регулированию и метрологии

3 ПРИНЯТ Межгосударственным советом по стандартизации, метрологии и сертификации (протокол от 1 июня 2017 г№ 51)

За принятие проголосовали:

Краткое наименование страны no МК (ИСО 3166) 004—97

Кор страны по МК (ИСО 3166)004—97

Сокращенное наименование национального органа по стандартизации

Армения

AM

Минэкономики Республики Армения

Беларусь

BY

Госстандарт Республики Беларусь

Казахстан

КZ

Госстандарт Республики Казахстан

Киргизия

KG

Кыргызстандарт

Россия

RU

Росстандарт

Таджикистан

TJ

Таджикстаидарт

Узбекистан

uz

Узстандарт

4 Приказом Федерального агентства по техническому регулированию и метрологии от 28 июня 2017 г. №593-ст межгосударственный стандарт ГОСТ 34104-2017 введен в действие в качестве национального стандарта Российской Федерации с 1 июля 2018 г.

5 ВВЕДЕН ВПЕРВЫЕ

Информация об изменениях к настоящему стандарту публикуется в ежегодном информационном указателе «Национальные стандарты», а текст изменений и поправок — в ежемесячном информационном указателе «Национальные стандарты». В случае пересмотра (замены) или отмены настоящего стандарта соответствующее уведомление будет опубликовано в ежемесячном информационном указателе «Национальные стандарты». Соответствующая информация, уведомление и тексты размещаются также в информационной системе общего пользования — на официальном сайте Федерального агентства по техническому регулированию и метрологии в сети Интернет (www.gost.ru)

© Стандартинформ. 2017

В Российской Федерации настоящий стандарт не может быть полностью или частично воспроизведен. тиражирован и распространен в качестве официального издания без разрешения Федерального агентства по техническому регулированию и метрологии

Линия ГМ кукурузы

Последователь

ность

Наименование

5'-3' последовательность

Bill

Целевая

Bill F

GCG GAA CCC СТА TTT GTT ТА

Btll R

ТСС AAG AAT CCC TCC ATG AG

Bill P

F AM- AAA TAC ATT CAA ATA TGT АТС CGC TCA -BHQ1

Растительная

Adh Bill F

CGT CGT TTC CCA TCT CTT CCT CC

Adh Btll R

CCA CTC CGA GAC CCT CAG TC

Adh Btll P

R6G- AAT CAG GGC TCA TTT TCT CGC TCC TCA -BHQ1

Т25

Целевая

T25F

АСА AGC GTG TCG TGC TCC AC

T25R

GAC ATG ATA CTC CTT CCA CCG

T25P

FAM- TCA TTG AGT CGT TCC GCC ATT GTC G -BHQ1

Растительная

Adh T25 F

CGT CGT TTC CCA TCT CTT CCT CCT

Adh T25 R

CCA CTC CGA GAC CCT CAG TC

Adh T25 P

R6G- AAT CAG GGC TCA TTT TCT CGC TCC TCA-BHQ1

MIR604

Целевая

MIR604 F

GCG CAC GCA ATT CAA CAG

MIR604 R

GGT CAT AAC GTG ACT CCC TTA ATT CT

MIR604 P

FAM- AGGCGGGAAACGAC AAT CT GAT CAT G-BHQ1

Растительная

Adh MIR604 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh MIR604 R

CCA CTC CGA GAC CCT CAG TC

Adh MIR604 P

R6G- AAT CAG GGC TCA TTT TCT CGC TCC TCA-BHQ1

MON 88017

Целевая

MON 88017 F

GAG CAG GAC CTG CAG AAG CT

MON 88017 R

TCC GGA GTT GAC CAT CCA

MON 88017 P

FAM- TCC CGC CTT CAG TTT AAA CAG AGT CGG GT -BHQ1

Растительная

Hmg MON 88017 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg MON 88017 R

GCT АСА TAG GGA GCC TTG TCC T

Hmg MON 88017 P

R6G- CAA TCC АСА CAA ACG CAC GCG ТА -BHQ1

3272

Целевая

3272 F

TCA TCA GAC CAG ATT CTC TTT TAT GG

3272 R

CGT TTC CCG CCT TCA GTT ТА

3272 P

FAM- ACT GCT GAC GCG GCC AAA CAC TG -BHQ1

Растительная

Adh 3272 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh 3272 R

CCA CTC CGA GAC CCT CAG TC

Adh 3272 P

R6G- AAT CAG GGC TCA TTT TCT CGC TCC TCA -BHQ1

MIR162

Целевая

MIR162F

GCG CGG TGT CAT СТА TGT TAC TAG

MIR162R

TGC CTT АТС TGT TGC CTT CAG A

MIR162P

FAM- TCT AGA CAA TTC AGT АСА TTA AAA ACG TCC GCC A -BHQ1

Растительная

Adh MIR162 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh MIR162 R

CCA CTC CGA GAC CCT CAG TC

Adh MIR162 P

R6G- AAT CAG GGC TCA TTT TCT CGC TCC TCA-BHQ1

ГОСТ 34104-2017

Продолжение таблицы 2

Линия ГМ кукурузы

Последователь

ность

Наименование

5'-3' последовательность

5307

Целевая

5307 F

CAT GGC CGT АТС CGC AAT GTG

5307 R

TGC ACC CTT TGC CAG TGG

5307 Р

FAM-ACC АСА АТА TAC CCT CTT CCC TGG GCC AG-BHQ1

Растительная

Adh 5307 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh 5307 R

CCA CTC CGA GAC CCT CAG TC

Adh 5307 P

R6G -AAT CAG GGC TCA TTT TCT CGC ТСС TCA-BHQ1

ВИ 76

Целевая

Btl 76 F

GGC CGT GAA CGA GCT GTT

Btl 76 R

GGG AAG AAG CCT АСА TGT TTT СТА A

Btl 7в P

FAM-AGC AAC CAG АТС GGC CGA CAC C-BHQ1

Растительная

Adh Btl 76 F

CGT CGT TTC CCA TCT CTT CCT CC

Adh Btl 76 R

CCA CTC CGA GAC CCT CAG TC

Adh Bt176 P

R6G-AAT CAG GGC TCA TTT TCT CGC TCC TCA-BHQ1

MON 98140

Целевая

MON 98140 F

GTG TGT ATG TCT CTT TGC TTG GTC TT

MON 98140 R

GAT TGT CGT TTC CCG CCT TC

MON 98140 P

FAM-CTC TAT CGA TCC CCC TCT TTG ATA GTT TAA ACT-BHQ1

Растительная

Hmg 98140 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg 98140 R

GCT АСА TAG GGA GCC TTG TCC T

Hmg 98140 P

R6G-CAA TCC АСА CAA ACG CAC GCG TA-BHQ1

MON87460

Целевая

Mon87460 F

CAC GTT GAA GGA AAA TGG ATT G

Moo87460 R

TCG CGA TCC TCC TCA AAG AC

Мол87460 P

FAM-AGG GAG TAT GTA GAT AAA TTT TCA AAG CGT TAG ACG GC-BHQ1

Растительная

Hmg Mon87460 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg Mon87460 R

GCT АСА TAG GGA GCC TTG TCC T

Hmg Mon87460 P

R6G-CAA TCC АСА CAA ACG CAC GCG TA-BHQ1

MON863

Целевая

МОЛ863 F

GTA GGA TCG GAA AGC TTG GTA C

Mon863 R

TGT TAC GGC СТА AAT GCT GAA CT

МолвбЗ P

FAM-TGA АСА CCC АТС CGA АСА AGT AGG GTC A-BHQ1

Растительная

Adh Mon863F

CCA GCC TCA TGG CCA AAG

Adh Mon863 R

CCT TCT TGG CGG CTT АТС TG

Adh Mon863 P

R6G-CTT AGG GGC AGA CTC CCG TGT TCC CT-BHQ1

ТС1507

Целевая

TCI 507 F

TAG TCT TCG GCC AGA ATG G

TCI 507 R

CTT TGC CAA GAT CAA GCG

TCI 507 P

FAM-TAA CTC AAG GCC CTC ACT CCG-BHQ1

Растительная

Hmg TCI 507 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg TCI 507 R

GCT АСА TAG GGA GCC TTG TCC T

Hmg TCI 507 P

R6G-CAA TCC АСА CAA ACG CAC GCG TA-BHQ1

9

Линия ГМ кукурузы

Последователь

ность

Наименование

5'-3' последовательность

59122

Целевая

59122F

GGGAT AAGC AAGT AAAAGCGCTC

59122 R

CCTT AATT CT CCGCT CAT GAT C AG

59122 Р

FAM-TTTAAACTGAAGGCGGGAAACGACAA-BHQ1

Растительная

Hmg 59122 F

GCT АСА TAG GGA GCC TTG ТСС T

Hmg 59122 R

TTG GAC TAG AAA TCT CGT GCT GA

Hmg 59122 P

R6G-CAA ТСС АСА CAA ACG CAC GCG TA-BHQ1

LY038

Целевая

LY038F

TGG GTT CAG TCT GCG AAT GTT

LY038R

AGG AAT TCG АТА TCA AGC TTA TCG A

LY038P

FAM-CGA GCG GAG TTT ATG GGT CGA CGG-BHQ1

Растительная

Hmg LY038 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg LY038 R

GCT АСА TAG GGA GCC TTG ТСС T

Hmg LY038 P

R6G-CAA ТСС АСА CAA ACG CAC GCG TA-BHQ1

DAS-40278-9

Целевая

DAS40278 F

CAC GAA CCA TTG AGT TAC AAT C

DAS40278 R

TGG TTC ATT GTA TTC TGG CTT TG

DAS40278P

FAM-CGT AGC TAA CCT TCA TTG TAT TCC G-BHQ1

Растительная

Hmg 40278 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg 40278 R

GCT АСА TAG GGA GCC TTG ТСС T

Hmg 40278 P

R6G-CAA ТСС АСА CAA ACG CAC GCG TA-BHQ1

Таблица 3— рапса

- Последовательности олигонуклеотидных праймеров и зондов для идентификации ГМ линий

Линия ГМ рапса

Последователь

ность

Наименование

5 -3 последовательность

GT73

Целевая

RT73-F

CC AT ATT GACC AT CATACT C ATT GCT

RF3-R

GCTT AT ACGAAGGC AAGAAAAGGA

RT73-Z

FAM-TTCCCGGACATGAAGATCATCCTCCTT-BHQ1

GT73

Растительная

Rape-CTuA-F

GGCC AGGGTTT CCGT GAT

Rape-cruA-R

CCGT CGTT GTAGAACCATT GG

Rape-cruA-Z

R6G- AGT CCTT AT GT GCT CC ACTTT CT GGT GC A- BHQ1

MON88302

Целевая

MON88302-F

T CCTT GAACCTT ATTTTAT AGT GCACA

MON88302-R

T CAGATT GT CGTTT CCCGCCTT C A

MON88302-Z

F AM - T AGTC АТС ATGTTGT ACC ACTTС AAAC AC T - В H Q1

Растительная

Rape-cruA-F

GGCC AGGGTTT CCGT GAT

Rape-caiA-R

CCGT CGTTGTAG AACC ATT GG

Rape-cruA-Z

R6G-AGT CCTT AT GT GCT CCACTTTCT GGT GCA- BHQ 1

MSI

Целевая

Msl-F

ACGCT GCGGACAT CTAC ATT

MS1-R

CT AG AT CGG AAGCT GAAGAT GG

MS1-Z

F AM-CT CATT GCT GAT CCACCTAGCCG ACTT-BHQ 1

Линия ГМ рапса

Последователь

ность

Наименование

5'-3‘ последовательность

MSI

Растительная

Rape-cruAF

GGCCAGGGTTT CCGT GAT

Rape-cruA-R

T C AGATT GT CGTTT CCCGC CTT CA

Rape-cruA-Z

R6G-AGT CCTT AT GT GCT CCACTTT CT GGT GCA-BHQ1

MS8

Целевая

MS8-F

GTT AGAAAAAGT AAACAATT AAT AT AGCCGG

MS8-R

GGAGGGTGTTTTTGGTTATC

MS8-Z

FAM-AAT ATAAT CGACGGAT CCCCGGGAATT C-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTT CCGT GAT

Rape-cruA-R

T C AGATT GT CGTTT CCCGC CTTCA

Rape-cruA-Z

R6G-AGT CCTT AT GT GCT CCACTTT CT GGT GCA-BHQ 1

Т45

Целевая

T45-F

C AAT GG ACAC AT G AATT ATGC

T45-R

GACT CTGTAT GAACT GTT CGC

T45-Z

FAM-TAGAGGACCTAACAGAACTCGCCGT-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTT CCGT GAT

Rape-cruA-R

T C AGATT GT CGTTT CCCGCCTT CA

Rape-cruA-Z

R6G-AGT CCTTAT GT GCT CCACTTTCT GGT GCA-BHQ 1

RF1

Целевая

RF1-F

CT AAGGG AGGT C AAG AT GT AGC

RF1-R

CGGGCCT AACTTTT GGTGTG

RF1-Z

F AM-CT CAT CAT CCT C ACCCAGT CAGCAT CA- BHQ1

Растительная

Rape-cruAF

GGCCAGGGTTT CCGT GAT

Rape-cruA-R

T CAGATT GT CGTTT CCCGCCTT CA

Rape-cruA-Z

R6G-AGT CCTT AT GT GCT CCACTTT CT GGT GCA-BHQ 1

RF2

Целевая

RF2-F

GGGT G AG AC AATAT AT CG ACG

RF2-R

GGGCATCGCACCGGT GAG

RF2-Z

F AM-CACCGGCCAAATTCGCTCTT AGCCGT-BHQ1

Растительная

Rape-cruA-F

GGCCAGGGTTT CCGT GAT

Rape-cruAR

T CAGATT GT CGTTT CCCGC CTTCA

Rape-cruA-Z

R6G-AGT CCTT AT GT GCT CCACTTTCT GGT GCA-BHQ 1

RF3

Целевая

RF3-F

CAT AAAGG AAG AT GGAGACTT GAG

RF3-R

AGC ATTTAGCAT GT ACC AT C AG AC A

RF3-Z

F AM-CGCACGCTT AT CGACCAT AAGCCCA-BHQ1

Растительная

Rape-cruAF

GGCCAGGGTTT CCGT GAT

Rape-cruA-R

T CAGATT GT CGTTT CCCGCCTT CA

Rape-cruA-Z

R6G-AGTCCTT AT GT GCT CCACTTT CT GGT GC A-8HQ1

Topas

19/2

Целевая

TOPAS 19/2-F

GTT GCGGTT CT GTC AGTT CC

TOPAS 19/2-R

CGACCGGCGCT GAT AT AT G A

TOPAS 19/2-Z

FAM-TCCCGCGTCATCGGCGG-BHQ1

Растительная

Rape-cruAF

GGCCAGGGTTT CCGT GAT

Rape-cruA-R

T CAGATT GTCGTTT CCCGCCTT CA

Rape-cruA-Z

R6G-AGT CCTTAT GT GCT CCACTTTCT GGT GCA-BHQ 1

6    Сущность метода

6.1    Сущность метода идентификации ГМ линий сои. кукурузы и рапса методом ПЦР с гибридиза-ционно-флуоресцентной детекцией в режиме реального времени (Real Time PCR) заключается в проведении двух независимых ПЦР в одной пробирке с использованием специфичных праймеров и зондов, меченных флуоресцентными красителями, с целью выявления участка видоспецифичной ДНК растений (сои. кукурузы или рапса) и части генно-инженерной конструкции, специфичной для генома тестируемой генетически модифицированной линии.

6.2    Метод состоит из следующих этапов:

-    экстракция и очистка ДНК: на данном этапе осуществляется лизис клеток с последующей очисткой ДНК от балластных веществ (белков, полисахаридов и других соединений):

-    ПЦР с использованием специфических праймеров и зондов, меченных флуоресцентным красителем. На данном этапе осуществляется накопление копий целевого участка ДНК и детекция ПЦР-про-дуктов в режиме «реального времени»;

-    анализ и интерпретация результатов происходит на основании наличия (или отсутствия) пересечения кривой флюоресценции с установленной на соответствующем уровне пороговой линией на графике зависимости интенсивности флюоресценции от количества циклов, что соответствует значениям порогового цикла Ct.

7    Отбор проб

Общие правила отбора проб для испытаний должны соблюдаться в соответствии с требованиями ГОСТ ISO 6497.

8    Экстракция ДНК

8.1    Экстракцию ДНК из анализируемой пробы осуществляют с использованием набора реагентов для экстракции ДНК сорбционным методом по 5.3 или иным методом, позволяющим получить достаточный объем ДНК для последующих исследований. Объем ДНК. необходимый для проведения исследований. вычисляют по формулам:

Уи=10 N.    (1)

где Vи — объем ДНК. необходимый для проведения идентификации линий;

N — количество идентифицируемых линий;

VK=10 2 N.    (2)

где VK — объем ДНК, необходимый для проведения количественного анализа.

8.2    Буфер для лизирующего реагента и раствор для отмывки № 1 (если они хранились при температуре от 2 °С до 8 “С) прогревают на поверхности твердотельного термостата при температуре от 60 °С до 64 вС до полного растворения кристаллов.

8.3    Отбирают необходимое количество одноразовых пробирок объемом 1.5 см3 (включая отрицательный контроль выделения). В пробирки вносят анализируемые пробы. В пробирку отрицательного контроля выделения ДНК вносят 100 мм3 ОКО.

8.4    Отдельными наконечниками с аэрозольным барьером вносят в каждую пробирку по 400 ммбуфера для лизирующего реагента и по 17 мм3 лизирующего реагента. Тщательно перемешивают содержимое пробирок на встряхивателе в течение 10 с.

8.5    Пробирки инкубируют в термостате при температуре 64 °С в течение 1 ч. периодически встряхивая на встряхивателе (пять раз через каждые 10—12 мин).

8.6    Нерастворенные частицы анализируемой пробы осаждают центрифугированием при 12—14 тыс. об/мин в течение 5 мин.

8.7    Надосадочную жидкость в объеме 200—350 мм3 очень аккуратно (так. чтобы не попали взвешенные частицы и капли жира) отбирают отдельными наконечниками с аэрозольными барьерами и переносят в новые пробирки.

8.8    Пробирки с надосадочной жидкостью прогревают в течение 5 мин в термостате при температуре 64 °С, перемешивают содержимое пробирок и центрифугируют в течение 5 с при 5 тыс. об/мин для сброса капель с крышки пробирки.

12

ГОСТ 34104-2017

8.9    В каждую пробирку отдельным наконечником добавляют по 25 мм3 сорбента, предварительно помещенного во встряхиватель для получения однородной суспензии. Содержимое пробирок перемешивают на встряхивателе и инкубируют при комнатной температуре в течение 10—15 мин, перемешивая через каждые 2 мин. Сорбент осаждают центрифугированием при 5 тыс. об/мин в течение 30 с. Надосадочную жидкость удаляют, используя вакуумный отсасыватель с колбой-ловушкой и отдельный наконечник для каждой пробы.

8.10    ВпробиркидобавляютпоЗООмм3растворадляотмывки№1.Перемешиваютнавстряхивате-ле до полного ресуспендирования сорбента. Сорбент осаждают центрифугированием при 5 тыс. об/мин в течение 30 с. Удаляют надосадочную жидкость, используя вакуумный отсасыватель с колбой-ловушкой и отдельный наконечник для каждой пробы.

8.11    Процедуру отмывки повторяют дважды, используя по 500 мм3 раствора для отмывки № 2. и центрифугируют в течение 30 с при 7 тыс. об/мин. удаляют надосадочную жидкость полностью.

8.12    Пробирки с отмытым сорбентом помещают в термостат при температуре 64 *С на 10 мин для подсушивания сорбента. При этом крышки пробирок должны бытьоткрыты.

8.13    В пробирки добавляют по 50 мм3 буфера для элюции ДНК и перемешивают на встряхивателе. Помещают в термостат при температуре 64 *С на 5 мин и периодически (один раз в минуту) встряхивают на встряхивателе. Пробирки центрифугируют при 12 тыс. об/мин в течение 1 мин.

8.14    Надосадочная жидкость содержит очищенную ДНК. которую затем используют для постановки ПЦР и проведения амплификации. Очищенную ДНК можно хранить в течение одной недели при температуре от 2 °С до 8 °С и в течение года при температуре не выше минус 16 вС. Для этого рекомендуется перенести надосадочную жидкость в чистую микропробирку.

9 Постановка ПЦР и проведение амплификации с гибридизационно-флуоресцентной детекцией в режиме реального времени (Real Time PCR)

9.1    Приготовление реакционной ПЦР-смеси

Для приготовления реакционной ПЦР-смеси для определения генетически модифицированной линии сои. кукурузы или рапса берут 1 мм3деионизированнойводы.по1 мм3 каждого соответствующего праймера с маркировкой «F» по 5.3.2 концентрацией 5 1 (Н5моль/дм3. no 1 мм3 каждого праймера с маркировкой «R» по 5.3.2 концентрацией 5 • 10-6 моль/дм3. no 1 мм3 каждого зонда с маркировкой «Р» по

5.3.2 концентрацией 3 10-6 моль/дм3, 3 мм3 раствора дНТФ и смешивают в пробирке вместимостью

1.5 см3. Срок хранения готовой ПЦР-смеси при температуре не выше минус 18 °С — не более 12мес.

9.2    Постановка ПЦР

9.2.1    ДНК. экстрагированную из анализируемой пробы (включая стандартные образцы), испытывают не менее чем в двух повторностях.

9.2.2    Для проведения ПЦР в одной пробирке смешивают 10 мм3 ПЦР-смеси по 9.1, к которой добавляют 5 мм3 ПЦР-буфера и 0.5 мм3 термостабильной Taq полимеразы. Смесь перемешивают на встряхивателе. осаждая кратковременным центрифугированием.

9.2.3    Вносят по 15 мм3 смеси, полученной по 9.2.2, в микропробирку вместимостью 0,2 см3, затем, используя наконечник с аэрозольным барьером, добавляют в нее 10 мм3 ДНК. полученной из анализируемой пробы (ДНК-проба) в соответствии с разделом 8. Общий объем реакционной смеси — 25 мм3.

Примечание — Необходимо избегать попадания сорбента в реакционную смесь.

9.3    Контрольные реакции амплификации:

-    отрицательный контроль ПЦР (К-) — вместо ДНК-пробы в микропробирку с 15 мм3смеси по9.2.2 вносят 10 мм3ТЕ-буфера;

-    положительный контроль ПЦР (К+) — вместо ДНК-пробы в микропробирку с 15 мм3 смеси по 9.2.2 вносят 10 мм31 %-ного стандартного образца состава ГМ сои, ГМ кукурузы или ГМ рапса.

9.4    Проведение амплификации и детекции флуоресцентного сигнала

Программируют прибор для проведения полимеразной цепной реакции в режиме реального времени в соответствии с инструкцией по эксплуатации.

Программы амплификации для идентификации линий ГМ сои. кукурузы и рапса различаются для разных ГМ линий и приведены в таблицах 4—11.

Программа амплификации для идентификации ГМ сои линий 40-3-2, А5547-127, А2704-12 приведена в таблице 4.

13

ГОСТ 34104-2017

Содержание

1    Область применения...................................................1

2    Нормативные ссылки..................................................1

3    Термины и определения................................................2

4    Условия выполнения исследований и требования безопасности.......................2

5    Оборудование, материалы, реагенты........................................3

6    Сущность метода....................................................12

7    Отбор проб........................................................12

8    Экстракция ДНК.....................................................12

9    Постановка ПЦР и проведение амплификации с гибридизационно-флуоресцентной детекцией

в режиме реального времени (Real Time PCR)..................................13

Приложение А (справочное) Требования к ПЦР-лаборатории.........................19

III

МЕЖГОСУДАРСТВЕННЫЙ СТАНДАРТ

КОРМА И КОРМОВЫЕ ДОБАВКИ

Метод идентификации генетически модифицированных линий сои, кукурузы и рапса с использованием ПЦР с гибридизационно-флуоресцентной детекцией в режиме реального

времени

Feed and feed additives. Method of identification of genetically modified events of soybean, maize and rapeseed using PCR with hybridization-fluorescence detection in real time

Дата введения —2018—07—01

1    Область применения

Настоящий стандарт распространяется на корма: фуражное зерно, продукты его переработки; растительные корма; комбикорма для продуктивных и непродуктивных животных и сырье для их производства; кормовые добавки и устанавливает метод идентификации генно-модифицированной сои (далее — ГМ сои), генно-модифицированной кукурузы (далее — ГМ кукурузы) и генно-модифицированного рапса (далее — ГМ рапса) методом полимеразной цепной реакции (далее — ПЦР) с гибридизационно-флуоресцентной детекцией в режиме реального времени (Real Time PCR).

2    Нормативные ссылки

В настоящем стандарте использованы нормативные ссылки на следующие межгосударственные стандарты:

ГОСТ 12.0.004-2015 Система стандартов безопасности труда. Организация обучения безопасности труда. Общие положения

ГОСТ 12.1.004-91 Система стандартов безопасности труда. Пожарная безопасность. Общие требования

ГОСТ 12.1.005-88 Система стандартов безопасности труда. Общие санитарно-гигиенические требования к воздуху рабочей зоны

ГОСТ 12.1.007-76 Система стандартов безопасности труда. Вредные вещества. Классификация и общие требования безопасности

ГОСТ 12.1.019-79 Система стандартов безопасности труда. Электробезопасность. Общие требования и номенклатура видов защиты*

ГОСТ 12.4.009-83 Система стандартов безопасности труда. Пожарная техника для защиты объектов. Основные виды, размещение и обслуживание ГОСТ ISO 6497-2014 Корма. Отбор проб

ГОСТ ISO 7218-2015 Микробиология пищевых продуктов и кормов для животных. Общие требования и рекомендации по микробиологическим исследованиям

ГОСТ ИСО/МЭК17025—2009 Общие требования к компетентности испытательных и калибровочных лабораторий

ГОСТ 24760-81 Халаты медицинские женские. Технические условия ГОСТ 25194-82 Халаты медицинские мужские. Технические условия

ГОСТ 26678-85 Холодильники и морозильники бытовые электрические компрессионные параметрического ряда. Общие технические условия

ГОСТ 31719-2012 Продукты пищевые и корма. Экспресс-метод определения сырьевого состава (молекулярный)

* В Российской Федерации действует ГОСТ Р 12.1.019-2009.

Издание официальное

Примечание — При пользовании настоящим стандартом целесообразно проверить действие ссылочных стандартов в информационной системе общего пользования — на официальном сайте Федерального агентства по техническому ретулированию и метролотии в сети Интернет или по ежегодному информационному указателю «Национальные стандарты», который опубликован по состоянию на 1 января текущего года, и по выпускам ежемесячного информационного указателя «Национальные стандарты» за текущий год. Если ссылочный стандарт заменен (изменен), то при пользовании настоящим стандартом следует руководствоваться заменяющим (измененным) стандартом. Если ссылочный стандарт отменен без замены, то положение, в котором дана ссылка на него, применяется в части, не затрагивающей эту ссылку.

3    Термины и определения

В настоящем стандарте применены следующие термины с соответствующими определениями:

3.1    амплификация: Процесс, многократно увеличивающий число копий фрагмента генома какого-либо организма.

3.2    генно-модифицированные (генно-инженерные, трансгенные) организмы; ГМО: Организм или несколько организмов, любое неклеточное, одноклеточное или многоклеточное образование, способные к воспроизводству или передаче наследственного генетического материала, отличные от природных организмов, полученные с применением методов генной инженерии и/или содержащие генно-инженерный материал, в том числе гены, их фрагменты или комбинации генов.

3.3    линия генно-модифицированного растения (генетически модифицированная линия, ГМ линия): Потомство от одного определенного генно-инженерно-модифицированного организма.

3.4    нуклеиновые кислоты; НК: Макромолекулы, являющиеся носителями генетической информации или выступающие в качестве посредника при синтезе полипептидной цепи.

3.5    нуклеотидная последовательность: Порядок чередования нуклеотидных остатков в НК.

3.6    отрицательный контроль ПЦР; К-: Реакционная смесь для проведения ПЦР. заведомо не содержащая целевой нуклеиновый материал.

3.7    отрицательный контроль выделения (контроль чистоты выделения); КВ: Контроль, прошедший все этапы выделения ДНК. но в отсутствие анализируемой пробы.

3.8    отрицательный контрольный образец: ОКО: Реакционная смесь, используемая вместо анализируемой пробы для контроля чистоты выделения ДНК.

3.9    полимеразная цепная реакция; ПЦР: Циклический ферментативный процесс, результатом которого является получение многочисленных копий определенного участка молекулы ДНК.

3.10    положительный контроль ПЦР; К+: Реакционная смесь для проведения ПЦР. заведомо содержащая целевой нуклеиновый материал.

3.11    полимеразная цепная реакция в режиме реального времени: Полимеразная цепная реакция, проводимая по специальной технологии, которая позволяет регистрировать накопление ПЦР-продуктов в процессе амплификации.

3.12    ПЦР-продукт: Фрагмент ДНК. амплифицированный в ПЦР.

3.13    праймер: Искусственно синтезируемая короткая последовательность нуклеотидов, комплементарная определенному участку целевой ДНК, используемая в полимеразной цепной реакции.

3.14    промотор: Последовательность нуклеотидов в молекуле ДНК, ответственная за начало транскрипции.

3.15    пороговый цикл Ct: Цикл амплификации, в котором кривая флуоресценции исследуемого образца пересекает линию порога (Threshold).

3.16    терминатор: Последовательность нуклеотидов в молекуле ДНК. ответственная за прекращение транскрипции.

3.17    целевая ДНК: Выбранная для амплификации последовательность ДНК.

3.18    экстракция ДНК: Обработка анализируемой пробы, высвобождающая ДНК.

3.19    элюция: Извлечение вещества из твердого носителя вымыванием подходящим растворителем.

4    Условия выполнения исследований и требования безопасности

4.1    Условия выполнения исследований

4.1.1    Общие требования к помещениям — по ГОСТ ISO 7218, ГОСТ ИСО/МЭК17025, ГОСТ 31719 (приложение А).

4.1.2    Требования к персоналу — по ГОСТ ISO 7218 и ГОСТ ИСО/МЭК 17025. 1

ГОСТ 34104-2017

4.2 Требования безопасности

4.2.1    В лаборатории должно быть организовано обучение персонала безопасности труда в соответствии с ГОСТ 12.0.004.

4.2.2    При работе с химическими реактивами необходимо соблюдать общие требования безопасности обращения с вредными веществами, установленные ГОСТ 12.1.007.

4    .2.3 Содержание вредных веществ в воздухе рабочей зоны не должно превышать норм, установленных ГОСТ 12.1.005.

4.2.4    При работе с электроустановками следует соблюдать требования электробезопасности, установленные в ГОСТ 12.1.019.

4.2.5    Помещение лаборатории должно соответствовать требованиям пожарной безопасности по ГОСТ 12.1.004, должно быть оснащено средствами пожаротушения по ГОСТ 12.4.009.

5    Оборудование, материалы, реагенты

5.1    Общие требования к оборудованию — поИСО/МЭК 17025.

5.2    При проведении испытаний применяют оборудование и материалы по ГОСТ 31719. с дополнением:

-    бокс ламинарный, класс биологической безопасности II тип А2:

-    термостат, обеспечивающий температуру нагрева до 100 вС;

-    отсасыватель вакуумный медицинский с колбой-ловушкой для удаления надосадочной жидкости;

-центрифуга для микропробирок вместимостью 1.5 см2, со скоростью вращения не менее 12000 об/мин;

-    миницентрифуги-встряхиватели с роторами для микропробирок вместимостью 0.2; 0.6 и 1.5 см2, со скоростью вращения не менее 2400 об/мин;

-    микропробирки одноразовые полипропиленовые завинчивающиеся или плотно закрывающиеся вместимостью 1.5 см2;

-    микропробирки одноразовые полипропиленовые вместимостью 0.2 см2;

-    одноразовые наконечники для дозаторов переменного объема с аэрозольным барьером объемом 10 мм2,100 мм2.200 мм2,1000 мм2;

-    ПЦР-бокс;

-    прибор для проведения полимеразной цепной реакции в режиме реального времени*;

-    халаты медицинские по ГОСТ 24760 и ГОСТ 25194;

-    холодильник бытовой электрический по ГОСТ 26678. обеспечивающий поддержание температуры от 2 °С до 8 вС. с морозильной камерой, обеспечивающей поддержание температуры не выше минус 16 °С.

Допускается использование другого оборудования, материалов стехническими характеристиками не ниже указанных.

Допускается использование роботизированных станций для проболодготовки. выделения дезоксирибонуклеиновой кислоты (ДНК) и раскапывания готовой многокомпонентной смеси для ПЦР.

5.3    При проведении испытаний применяют реагенты для экстракции ДНК. реагенты, праймеры и зонды для проведения ПЦР и амплификации. Для экстракции ДНК допускается использовать готовые наборы**.

5.3.1 Реагенты:

а) набор реагентов для экстракции ДНК. включающий:

1)    буфер для лизирующего реагента, содержащий хаотропный агент гуанидин хлорид;

2)    лизирующий реагент, содержащий протеиназу К;

3)    раствор для отмывки № 1 для очистки от клеточных белков, содержащий хаотропный агент гуанидин тиоцианат;

* Прибор для проведения ПЦР «Rotor-Gene» 2000/3000/6000 («Corbett Research». Австралия). «Rotor Gene Q» («Qiagen», Германия). Данная информация является рекомендуемой и приведена для удобства пользователей настоящего стандарта.

** Примером могут служить наборы «ДНК-СОРБ-С» (ФГБУН ЦНИИ Эпидемиологии Роспотребнадзора, форма 1 ref К1-6-50/ver. 05/08/16). «Сорб-ГМО-А» и «Сорб-ГМО-Б* (ЗАО «Синтол». каталожный номер GM-503). Данная информация является рекомендуемой и приведена для удобства пользователей настоящего стандарта.

4)    раствор для отмывки № 2 для очистки от солей, содержащий водный раствор изопропилового спирта;

5)    сорбент (25 %-ная взвесь частиц силикагеля Si02 размером от 20 до 50 мкм в растворе Трис-НС1 молярной концентрации 5 ммоль/дм3);

6)    буфер для элюции ДНК (ТЕ-буфер) — Трис-HCI молярной концентрации 10 ммоль/дм3; натриевая соль этилендиаминтетрауксусной кислоты молярной концентрации 1 ммоль/дм3;

б)    вода деионизированная, класса чистоты I. свободная от рибонуклеаз. дезоксирибонуклеаз, неорганических и органических примесей с удельным сопротивлением не менее 18 Мом см;

в)    ПЦР-буферсМдС12;

г)    смесь олигонуклеотидов (праймеры) по 5.3.2 или 5.3.3;

д)    смесь олигонуклеотидов (зонды, меченные флуоресцентными красителями FAM и R6G) по

5.3.2 или 5.3.3;

е)    раствор дезоксинуклеозидтрифосфатов (дНТФ), содержащий натриевые соли дНТФ со степенью очистки более 98 % и концентрацией каждой 2 моль/дм3;

ж)    термостабильная Taq-полимераза;

и) сертифицированные стандартные образцы ГМ линий сои. ГМ линий кукурузы или ГМ линий рапса*.

Допускается использование других реагентов с техническими характеристиками не хуже указанных.

5.3.2    Для выявления фрагментов видоспецифичной ДНК растений допускается использование наборов реагентов (готовых тест-систем), содержащих праймеры, специфичные к ДНК определенного вида растений.

5.3.3    Допускается использование синтезированных олигонуклеотидных праймеров и зондов для идентификации ГМ линий сои. кукурузы и рапса. Список последовательностей всех используемых олигонуклеотидов приведен в таблицах 1—3, где указаны последовательности;

1)    для прямых и обратных праймеров и зондов**, специфичных конкретной ГМ линии;

2)    прямых и обратных праймеров и зондов, специфичных фрагменту генома растения (ген лектина для сои. ген зеина для кукурузы, ген круциферина А для рапса).

Таблица 1 — Последовательности олигонуклеотидных праймеров и зондов для идентификации ГМ линий сои

Линия ГМ сои

Послодова тольность

Наиме нова нив

5-3 последовательность

40-3-2

Целевая

40-3-2F

GCC AT GTT GTT AATTT GT GCC AT

40-3-2R

G AAGTT С ATTT С ATTT GG AGAGG AC

40-3-2Р

FAM-CTT GAAAGAT CT GCT AGAGT CAGCTT GT CAGC G-BHQ1

Растительная

Lec40-3-2F

T CCACCCCCAT CCACATTT

Lec40-3-2R

GGC AT AGAAGGT GAAGTT G AAGGA

Lec40-3-2P

R6G-AACCGGT AGCGTT GCCAGCTT CG-BHQ1

А5547-127

Целевая

A5547F

GCT ATTT GGT GGCATTTTT CCA

A5547R

CACT GCGGCCAACTT ACTTCT

А5547Р

FAM-CCGCAAT GT CAT ACCGT CAT CGTT GT-BHQ1

Растительная

LecA5547F

CTTT CT CGCACC AATT GACA

LecA5547R

T С AAACT С AAC AGCGACG AC

LecA5547P

R6G-CC AC AAACACAT GCAGGTTAT CTT GG-BHQ1

* Сертифицированные стандартные образцы производства IRMM. Бельгия. AOCS. США (материалы, состоящие из высушенной гомогенизированной муки соевых бобов, рапса или кукурузы, включающих смеси ГМ и не ГМ растений соответствующих видов, содержащие от 0.1 % до 100 % генетически модифицированных материалов). Данная информация является рекомендуемой и приведена для удобства пользователей настоящего стандарта.

Маркировки в наименовании. «F» — прямой праймер. «R» — обратный праймер. «Р* — зонд.

ГОСТ 34104-2017

Продолжение таблицы 1

Линия ГМ сои

Последовательность

Наименование

5‘-3' последовательность

А2704-12

Целевая

A2704F

GCAAAAAAGCGGTTAGCTCCT

A2704R

ATT C AGGCT GCGC AAC TGTT

А2704Р

F AM-CGGT CCT CCGAT CGCCCTT CC- BHQ1

Растительная

LecA2704F

CACCTTT CT CGCACC AATT GAC A

L6CA2704R

T CAAACTCAACAGCGACGAC

1есА2704Р

R6G-CC AC AAAC AC AT GCAGGTT AT CTT GG- BHQ 1

MON89788

Целевая

MON89788F

T CCCGCT CT AGCGCTT С AAT

MON89788R

T CCCGCT CT AGCGCTT С AA

MON89788P

F AM-CTG AAGGCGGGAAACGACAATCTG-BH Q1

Растительная

LecMON89788F

CCAGCTT CGCCGCTT CCTTC

LecMON89788R

GAAGGCAAGCCCAT CT GCAAGCC

LecMON89788P

R6G-CTT С ACCTT CT AT GCCCCT GACAC-BHQ1

MON87701

Целевая

MON87701F

T GGT GAT AT GAAG AT AC AT GCTT AGC AT

MON87701R

CGTTT CCCGCCTT C AGTTT AAA

MON87701P

F AM-T CAGTGTTT GACACACACACT AAGCGT GCC-B HQ1

Растительная

Lec87701F

CCAGCTT CGCCGCTTCCTT C

Lec87701R

GAAGGCAAGCCCAT CT GCAAGCC

Lec87701P

R6G-CTT C ACCTT CT AT GCCCCT GACAC-BHQ 1

BPS-

CV127-9

Целевая

BPSF

AACAGAAGTTT CCGTT GAGCTTT AAGAC

BPSR

CATT CGT AGCT CGG AT CGTGT AC

BPSP

F AM-TTTGGGGAAGCT GTCCCAT GCCC-BHQ1

Растительная

LecBPSF

CCAGCTT CGCCGCTT CCTTC

LecBPSR

GAAGGCAAGCCCAT CT GCAAGCC

LecBPSP

R6G-CTT C ACCTT CT AT GCCCCT GACAC-BHQ 1

SYHTOH2

Целевая

SyhF

GGG AATT GGGT ACC AT GCC

SyhR

T GT GT GCC ATT GGTTT AGGGT

SytiP

F AM-CC AGC ATGGCCGTATCCGCAA-BHQ1

Растительная

LecSyhF

CCAGCTT CGCCGCTT CCTT C

LecSyhR

GAAGGCAAGCCCAT CT GCAAGCC

LecSyhP

R6G-CTT C ACCTT CT AT GCCCCT GACAC-BHQ 1

FG72

Целевая

FG72F

AGATTT GAT CGGGCT GCAGG

FG72R

GCACGT ATT GAT GACCGCATTA

FG72P

FAM- AAT GT GGTT CAT CCGT CTTTTTT G-BHQ1

Растительная

LecFG72F

CTTT CT CGCACCAATT G АСА

LecFG72R

T С AAACT C AACAGCGACG AC

LecFG72P

R6G-CC AC AAAC ACAT GCAGGTT AT CTT GG- BHQ 1

DP-305423

Целевая

305423F

CGT GTT CT CTTTTTGGCT AGC

305423R

GT GACC AAT GAAT ACAT AAC AC AAACT A

305423P

FAM-T GAC ACAAAT GATTTT CAT ACAAAAGT CGAGA-BHQ1

5

Линия ГМ сои

Поелоловательное тъ

Наименование

5 -3 последовательность

DP-305423

Растительная

Lec305423F

CCAGCTT CGCCGCTT CCTT C

Lec305423R

GAAGGC AAGCCCAT CT GC AAGCC

Lec305423P

R6G-CTT CACCTT CT AT GCCCCT GAC AC- BHQ1

DP-356043

Целевая

356043F

GT CGAAT AGGCTAGGTTT ACGAAAAA

356043R

TTT GAT ATT CTT GGAGT AGACG AGAGT GT

356043Р

F AM-CT CT AG AGAT CCGT С AAC AT GGT GGAGC AC- BH Q1

Растительная

Lec356043F

CCAGCTT CGCCGCTT CCTT C

Lec356043R

GAAGG C AAGCCCAT CT GC AAGCC

Lec356043P

R6G-CTT CACCTT CT AT GCCCCT GAC AC- BHQ 1

MON87705

Целевая

Mon87705F

TT CCCGG AC AT G AAGCC ATTT AC

Mon87705R

ACAACGGT GCCTT GGCCC AAAG

Moo87705P

F AM-AAGAGACT CAGGGT GTTGTTAT CACT GCGG-BH Q1

Растительная

LecMon87705F

CCAGCTT CGCCGCTT CCTT C

LecMon87705R

GAAGGC AAGCCCAT CT GCAAGCC

LecMon87705P

R6G-CTT CACCTT CT AT GCCCCT GACAC- BHQ 1

MON87708

Целевая

Moo87708F

T CAT ACT C ATT GCT GAT CC AT GT AG

Mon87708R

AG AAC AAATT AACGAAAAGAC AGAACG

Mon87708P

F AM- T CCCGGACTTT AGCT С AAAAT GC AT GT A- BH Q1

Растительная

LecMon87708F

CCAGCTT CGCCGCTT CCTT C

LecMon87708R

GAAGGC AAGCCCAT CT GCAAGCC

LecMon87708P

R6G- CTTC ACCTTCTAT GCCCCT GACAC- BHQ 1

MON87769

Целевая

Mon87769F

CAT ACT CATT GCT GAT CCAT GT AG ATT

Moo87769R

GC AAGTT GCT CGT GAAGTTTT G

Mon87769P

FAM-CCCGGACATGAAGCCATTTACAATTGAC-BHQ1

Растительная

LecMon87769F

CCAGCTT CGCCGCTT CCTT C

LecMon87769R

GAAGGC AAGCCCAT CT GCAAGCC

LecMon87769P

R6G-CTT CACCTT CT AT GCCCCT GAC AC- BHQ 1

DAS-44406

Целевая

DAS-44406F

TTA TTG TTC TTG TTG TTT CCT CTT TAG G

DAS-44406R

CCT CAA TTG CGA GCT TTC TAA TTT

DAS-44406P

FAM- ATT CGG ACC TCC ATG ATG ACC TTA CCG TT -BHQ1

Растительная

LecDAS-44406F

CCA GCT TCG CCG CTT CCT TC

LecDAS-44406R

GAA GGC AAG CCC АТС TGC AAG CC

LecDAS-44406P

FAM- CTT CAC CTT СТА TGC CCC TGA CAC- BHQ1

DAS-81419

Целевая

DAS 81419F

TCT AGC СТА TAT TTA GCA CTT GAT ATT CAT

DAS81419R

GCT TCA AGA TCC CAA CTT GCG

DAS 81419P

FAM-ATC AAC AGG CAC CGA TGC GCA CCG- BHQ1

ГОСТ 34104-2017

Окончание таблицы 1

Линия ГМ сои

Последовательность

Наименование

5 -3' последовательность

DAS-81419

Растительная

Lee DAS81419F

CCA GCT TCG CCG CTT CCT TC

LecDAS 81419R

GAA GGC AAG CCC АТС TGC AAG CC

LecDAS 81419Р

FAM-CTT CAC CTT СТА TGC CCC TGA CAC- BHQ1

DAS-68416

Целевая

DAS 68416F

GTA CAT TAA AAA CGT CCG CAA TGT GT

DAS 68416R

GTT TAA GAA TTA GTT CTT АСА GTT TAT TGT TAG

DAS 68416P

FAM-TTA AGT TGTCTA AGC GTC AAT A-MGBNFQ

Растительная

Lee DAS 68416F

CCA GCT TCG CCG CTT CCT TC

LecDAS 68416R

GAA GGC AAG CCC АТС TGC AAG CC

LecDAS 68416P

FAM-CTT CAC CTT СТА TGC CCC TGA CAC- BHQ1

Таблица 2 — Последовательности олиюнуклеотидных праймеров и зондов для идентификации ГМ линий куку-рузы

Линия ГМ кукурузы

Последователь

ность

Наименование

5'-3' последовательность

GA21

Целевая

GA21 F

CTT АТС GTT ATG СТА TTT GCA ACT TTA GA

GA21 R

TGG CTC GCG АТС CTC CT

GA21 Р

FAM- CAT АТА СТА ACT CAT АТС TCT TTC ТСА АСА GCA GGT GGG T -BHQ1

Растительная

Adh GA21 F

CCA GCC TCA TGG CCA AAG

Adh GA21 R

CCT TCT TGG CGG CTT АТС TG

Adh GA21 P

R6G- CTT AGG GGC AGA CTC CCG TGT ТСС CT - BHQ1

MON810

Целевая

Мол810 F

TCG AAG GAC GAA GGA CTC TAA CGT

Мол810 R

GCC ACC TTC CTT TTC CAC TAT CTT

Мол810 P

FAM- AAC АТС CTT TGC CAT TGC CCA GC -BHQ1

Растительная

Hmg Mon810 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg Mon810 R

GCT АСА TAG GGA GCC TTG ТСС T

Hmg Mon810 P

R6G- CAA ТСС АСА CAA ACG CAC GCG ТА -BHQ1

MON89034

Целевая

МОЛ89034 F

TTC ТСС ATA TTG ACC АТС АТА CTC ATT

Мол89034 R

CGG TAT СТА TAA TAC CGT GGT TTT TAA A

Мол89034 P

FAM-ATCCCCGGAAATTATGTT-MGBNFQ

Растительная

Hmg Mon89034 F

TTG GAC TAG AAA TCT CGT GCT GA

Hmg Mon89034 R

GCT АСА TAG GGA GCC TTG ТСС T

Hmg Mon89034 P

R6G- CAA ТСС АСА CAA ACG CAC GCG ТА -BHQ1

NK603

Целевая

NK603F

ATG AAT GAC CTC GAG TAA GCT TGT TAA

NK603R

AAG AGA TAA CAG GAT CCA CTC AAA CAC T

NK603P

FAM- TGG TAC CAC GCG АСА CAC TTC CAC TC -BHQ1

Растительная

Agh NK603F

CCA GCC TCA TGG CCA AAG

Agh NK603 R

CCT TCT TGG CGG CTT АТС TG

Agh NK603 P

R6G- CTT AGG GGC AGA CTC CCG TGT TCC CT -BHQ1

1

2